Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

نویسندگان

  • N. Hoosain
  • S. Nene
  • B. Pearce
  • C. Jacobs
  • M. Du Plessis
  • M. Benjeddou
چکیده

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases. Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot multiplex assay. Minor allele frequencies (MAF) were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%). Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population. Keywords—OCT1, PCR, SNaPshot assay, Zulu population.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1) in the Xhosa population of South Africa

Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs,...

متن کامل

Genetic relationships among collections of the Persian sturgeon, Acipenser percicus, in the south Caspian Sea detected by mitochondrial DNA Restriction fragment length polymorphisms

In the present study, mitochondrial DNA polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay was used to assess the population structure and genetic relationships among six Persian sturgeon, Acipenser persicus populations from south Caspian Sea along the Iranian coast. The complete nucleotide dehydrogenase subunit 5 (NADH 5) region of mtDNA amplified by PCR was di...

متن کامل

Analysis of IL-33 Gene Polymorphisms (rs1157505C/G and rs11792633C/T) and the Risk of Tuberculosis in Southeastern Iran

Tuberculosis is a vagarious infectious disease that generally affects the lungs. Accordingly, in some cases, it can also affect the liver and kidney. Host genetic may affect tuberculosis caused by bacillus Mycobacterium tuberculosis. The main risk factors for the disease are a weakened immune system because of diabetes, some cancers, HIV/AIDS, severe kidney disease, cancer treatment, a...

متن کامل

Evaluation of VNTR polymorphisms of dopamine transporter gene and the risk of bipolar disorder in Zahedan, southeast Iran

The exact role of dopamine transporter gene (DAT1) in the pathogenesis of bipolar disorder type 1 (BD) is not understood. In the present study, we aimed to evaluate the possible association between 30, 40 and 63 bp variable number tandem repeat (VNTR) polymorphisms of DAT1 gene and the risk of type 1 (BD) in a sample of Iranian population. This case-control study was performed on 152 BD patient...

متن کامل

Haplotype Effect of Two Human Leukocyte Antigen-G Polymorphisms of rs1736933 and rs2735022 on the Recurrent Pregnancy Loss

Background: Recurrent Pregnancy Loss (RPL) is a multifactorial disease that affects 1-3% of couples. Since Human Leukocyte Antigen-G (HLA-G) gene is involved in fetal maternal immune tolerance, mutations in the HLA-G gene can affect the success rate of pregnancy. Objective: The present study aims to investigate the haplotype effect of rs1736933 and rs2735022 polymorphisms found in the HLA-G ge...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره   شماره 

صفحات  -

تاریخ انتشار 2014